Mouse Models Mus Musculus

Mouse Models Mus Musculus

The instructions for assembling every organism on the planet--slugs and sequoias, peacocks and parasites, whales and wasps--are all specified in DNA sequences that can be translated into digital information and stored in a computer for analysis. As a consequence of this revolution, biology in the 21st century is rapidly becoming an information science... ...hypotheses will arise as often in silico as in vitro. Eric Lander, Science 287 (5459), 1777-1782 Bioinformatics

...TGTTATTGCCAATGCATCATGATCGTAGAGATGTAGGCTAAAGAAACTTTTTTAAAGTGTGATTTTACACAGCAGCTGGTGGTTACTGCTTAGCCATAAAATTATGTGTTGATATTGACATAAGTGGAATGTCGAAAACATGTTTATTCATACACGTATATTGTTG AAAGAAGTGTTAAACACATCATACGTTTAAAGTAGACAAATCTAGAAATATATAACAAAAGAGAATTTGTTTGTACATTTAAAAAGCCTTAGCTCTTTTTGAGCAAAATATGTAATATTATAATTTCAACACTTTTGAGTGTGTTTACTAAAACTAACAACCTTTAT GAAGCAATTGGGATGGGTTTGTGTGATCTAAAATTGAGGTAGGATCGTGGGACCAGGAGAACATGAGATGCATCGAAGGCAAAGTCCAAAGACACTACGTCACTTTGAGTGGATTGTGTACGTGAGGTTGTACGAACCATCATTTCACGTTACATATGTTGCAAC GCTGCGTAATCTGTCCCCACCATCCAACTTATTTCTAATTCTTTTTCATAATTATATTTGTATCTAAACTAAGTAGAATACCTACATATTGAAAAGAAATATTACTTGCTAGGGCCTAGGGATAAACGTTAAAGAGAAATATTACTATAGAGAAAAACCCTTTAGTTT TGAACACAATTTCTATGTGTAAACATGCGTGATTGTTATGTAGGCAGATGTGCACTAAGCACTTAAACAGAAAAAGAGACAAGTTTTGAACATGAGTTATGAGTAAAACATATAATTATAAAGTTTTGAACATGAGTTATGAGTAAAAACATATCATTATAAAGTT TTGAGAGCATCTATGAGTAAAAACAGACTAAATTAAATAGAACATATATATGGACAATATAGCAAGTAAAATCTCTCGGACTGACGAAATAGATGTAACTATACTACCAATGCTTGCGATTCAAACCGTCAAAAGTGAAAAATACTGTGAAATAACAAGTCAACT TCTATAAATGAAAATTAATATATATTGTAGACGGTTTATATATACGTTTGGATCATATCGATTCACTAATAAAAAAGTAACAAGTGTTATTCCACAAGTTGCATTTTTCATTTGTCTATAAGAACTTTATTGATCTTAAATAACGTTTATGCTTTTTCTTACACATATA TGGAACCGAATTCAACAAAAACTTTCAAATAGATTTGTTTTATATGAACACAATTATGTATATTGATTGTCCATTTATGAAGAAAAGAATAATCTTATGCTTCACACCGTTGACAAAAAAAGATAAACGTATGTCATTAACCCTCTCTTTTTCTGGTACATGTCAGA GCAAAGAAAATTTACTAAAAGGTTATTTTGTTTTTCCTTGTTTGTCTATAAATCTACTGAAAGCTTTAAATGCAATTTTATTATTTTCAAGAATCGGTCTTTTTACACTTCCGCGATACTAGCTAAAGGAATGTACACGTGTCAGGATATTATTGTAGCATCTGATTTT TACCATTGATGGTAACTAAAGTTAGTAACAGAACCATCAGGTCCATCACCGTAAAATATGACTAGCACAGTAGCACCTTTACCAGAAAATAACGCCGTTAGCTGTTTTCATCAAGTCAACAACAACCATTTTAACGGCAGTTTAGATATATTTTAATTTTTTTTAAC CATATATCATTGGAAGTAAAAAGTTGTCATACTAAAATATATATCTTTTAAGATCTCAAGGTAATTAAAAAAATAATCAAAGACGCTTAAAATCTGAAATTTTCAATAAAGTAATCATAAATTATTTTATGATTTAAATTTAGGTTTATCATAATAATCTTGAAAGA AATTAAATAATATAATAGTTTTAAGGAAATCTATTTATTTGTTTTTTGATAAATTACATATCTATAGTAAATTAATGATATTGAATGGTGTAGTTGGTTTCTCATAGGTAGAATTAAGACTTTCTCTTTTGTATTAATAAAATTTTATTTGACAACAAACAGAAGAAA CCTTTTAATAAATTGAGAGAGATATACTATAGGACATGATATGACAAAACTGTCCTACTCAGTGAACTTCACTAACAGAGCTCAAATTTGAAATCTCAATGAATTAATATTTAATGACATAACAAGTCAAAGTGATGATATTAAATCTTTCCTCCTTGACAAGACGA TAATACTTCAATTAACAAAAAAAAAAAAAAAAAGAGATGATAATTTTTCCAGAATAAAATATTTTCGACTTGGACTGGGAATAAAAAAAATGGGGTGACCTAAACCGACGTCGCATAGTTACGAGAGGCATATAAATAGAGAGCCACCAAATAGCCTAACGTAG

TCCACCTTCACTTGCTCTCTTTTTTCCGAAGAATCTGGTTCGTTTCTCTTTGAATTATCTCTTTCTCTGTTCTTCTTCTTTTTCTAAAGTCTCGAATATATCTTCATTATCATTACTTTATTTGCTTCGTTCTTCCGCAGTTTTGTGCAAAGTTTTAACGATTTTTTGGTTTT GAACGAAGGCACAGAGAGAAGATGGCGAGTGGCCTCGAGGATATCGTGAACGAGAATGTTGATTTGGTATGGATTTCTTCTTTTTACTCTGTATATATTTTTTTGTTTCGTTTGTTTAACTTGTTTAATGAATATACGAGAGGAAAGTTTAGTTTGGTTTTGTTTTTT ACTTAACGATTCGATCAAATTAGGGTTGTACACAAATCTCGTTACATCATCGTTGAACTATTGACTTCATGTTTTAGCATGAGATTTTTATTGTTTGATTTCGATGAGAAAAGAATCCATGAAAAAGTGTTAATATTATCATAATTATTTCAGTTTTTCTGCTTTTTTT TCAAAATTACTTTTTCTTTATTTATTTTTTTATTAGATTTTGCAACTGCACTAATTTAAAACAATTTGCAGTCACCAGAAATTTAGTTACAATTATGTAAAAGTTGTTTCCAAATAAAGCAAAAGTAATTACATTAGTAGTACTCTCTACTTTCACATGATCTATCTTA ATGAGTATACTTTGAGATTTCTTAGAGAAGTTTTAGTCAATTCTGTTTTCAATTACTACGTTTTTGGATTTTTCATACTCATGGAATATCGCCTTATCAATCGGTTAATCACTTCCCTAGATAAAACTAAACTTCAATCTTCACCTGATTTTCTGGACTCAATTTAAGA TACCATGTTATATAGACAGATTTGCCCCTATCAATACATCTTCCGTTACAATGGGCCTTATTGGGCCTTTAGGCTTATTATATAAGCGAATTAAAGTACAAGGCCTTGTGGTCCCACCTTAGATTCTCTGACATCGACAGCTACAGAACATTCCATAATTTTGGTCAT CTAATATTTTTATGCTTTGATAAATAATTATAATCTTGATTATCTATTAATTTGCATGCTTATATTTTTTTCTTTTTTTTTGCTTTTTTTAGTACTGTAAAAGGTTAACATTTGTATCTGTAAAAAAGATGTACTACAGATAAAAACATACTTGGTTGTTTATTGGTGTA GGAGATACATAATTATTGAACACCATTTGAATTAGTCTAACATCGTGTTCATATTATATTGCAGGAGAAAATACCTATTGAGGAAGTGTTCCAGCAGTTGAAATGCAGCAGAGAAGGTTTATCTGGAGCAGAAGGAGAAAACAGACTCCAGATCTTTGGCCCCAAC AAACTCGAGGAGAAGAAGGTATAGTTTGGTTTTAACCATTATCAAAGTCATCATACATGAGCTAAGTCACTAACTATGTAATGGTGGTTTCAATAAATAGGAAAGCAAGTTACTCAAGTTCTTGGGTTTTATGTGGAACCCTCTCTCTTGGGTCATGGAAGCAGCTG CAATCATGGCTATTGCCTTGGCTAATGGCGGTGGAAAGCCACCGGATTGGCAAGATTTTGTCGGTATCGTTTGTCTTTTGGTTATCAATTCAACTATCAGTTTTGTCGAAGAAAACAATGCTGGAAATGCTGCTGCTGCTCTTATGGCTGGTCTTGCTCCCAAAACTA AGGTCCCTCTTTATAAACTCCCTTCAAATACTCCTCTTTGCATTAGCATTTACGTGTATGTTTACTGTATACTTGGCATACGAATTACGCGAGTTTAACTATGTTACATAATTAGATTCTTAGCACCTAGTAGTTGTCTAACTTGAAAATGTTTGGCATAAGTAATTGG TTTACATATAATTTCATTACAAGCTTTTAATAATATTTGTTTTGTTATGACCAGGTTCTAAGAGATGGCAAATGGTCAGAGCAAGAAGCTTCTATTCTTGTTCCTGGAGATATTGTGAGCATCAAGCTTGGTGACATCATTCCTGCTGATGCACGTCTTCTTGAAGGT GATCCTTTAAAAGTCGACCAATCTGCTTTGACCGGAGAATCTCTTCCCGCAACGAAAGGTCCAGGGGAAGAAGTTTTCTCCGGTTCTACCTGCAAGCAAGGTGAGATTGAAGCGGTTGTGATAGCCACTGGAGTCCATACTTTCTTCGGTAAAGCGGCTCATCTAGT CGACAGCACAAACCAAGTTGGACATTTCCAGAAAGTTCTTACGGCGATTGGAAACTTCTGCATATGTTCCATAGCTGTTGGTATTGCGATTGAGATCGTTGTCATGTATCCGATCCAGCGCAGACACTACAGAGACGGAATCGACAATCTTCTTGTTCTTTTGATTG

GTGGTATCCCCATTGCAATGCCTACTGTCTTGTCTGTCACAATGGCTATTGGATCTCACAAGTTGTCTCAACAAGGAGCTATCACAAAACGAATGACCGCCATTGAAGAAATGGCTGGTATGGATGTTCTGTGCAGCGATAAAACCGGGACTCTCACGCTAAACAA GCTTAGTGTTGACAAGAATCTTATTGAGGTTTATTGTAAAGGCGTTGAGAAAGATGAAGTTTTGCTTTTTGCTGCTAGAGCTTCAAGAGTTGAGAACCAAGATGCTATTGATGCTGCTATGGTTGGAATGCTCGCTGATCCAAAAGAGGTAATATATATAACTCTGT TTTTTCCTCTGTTTTAAAATTCTGTTTTTTCCTCTGTTTTGTTTCTTGAAGAAAATGTTCTGTTCTGTTTCTCATTGTTTGTTTCTTTCAGGCAAGAGCTGGAATCAGAGAGATTCACTTCCTACCATTCAATCCAGTTGATAAGCGAACCGCTTTGACGTTTATCGACA GCAACGGAAACTGGCACCGAGTAAGCAAAGGAGCTCCCGAGCAGGTAACTAAAACTGATTTTGGTTCTTAAGCTAAGTTAAGTGTTGTGACTTCTTAAAAAAACTGATTCTTTGATGATTTCAGATTCTTGATCTCTGTAACGCGAGAGCTGATCTGAGGAAGAGA GTCCACTCTACAATCGATAAGTACGCTGAGCGTGGACTTAGGTCATTAGCTGTTTCAAGACAGGTGAGAAGAAATCTTACATTTTGTAACAAGTTATAGGAAGAAGGAAAAAGAGAGAGAGAGTTTAATGTAAATTTTGTGTGTCTATGTTTCAGACTGTACCAGA GAAAACAAAAGAAAGCTCTGGTAGTCCATGGGAATTTGTTGGTGTGTTGCCTCTGTTTGATCCTCCAAGACATGATAGTGCCGAAACCATTAGAAGAGCTCTAGACCTCGGTGTCAATGTCAAGATGATTACTGGTTTATATCTAAACATTACTCTTCGCTATAGCG AAAACACCGAATTTCTTACTAATGTTTCCAATGGTTTTATAGGTGATCAACTTGCTATTGCGAAAGAGACAGGACGTAGACTTGGAATGGGATCAAACATGTACCCATCCTCTTCTTTACTCGGTAAACACAAAGACGAAGCCATGGCTCACATTCCTGTTGAGGAT TTGATTGAGAAAGCTGATGGCTTTGCTGGAGTCTTCCCAGGTTTGTTTAAGAGCCATTTTTGTTTCCACAAACACAAACTTGCTCTTCTCTCTGTAACATTTGGTCTCTTTTTTTTCTTTACCAAATTCATTCAGAGCACAAATACGAAATTGTGAAGAAGTTGCAAGA AAGGAAGCATATCTGTGGTATGACTGGAGATGGAGTGAATGACGCTCCAGCATTGAAGAAAGCGGATATAGGTATCGCTGTGGCGGATGCAACTGACGCTGCACGAGGTGCTTCTGATATTGTCCTCACCGAGCCAGGTCTCAGTGTGATCATCAGCGCGGTTCTA ACCAGTAGAGCCATCTTCCAGAGAATGAAGAACTACACAGTGAGTGTTCTCTTAATCTTAAACCATAACCTTTTTAGAATCTTTACACCATGATAACTTGTTCTCATGGTGTTTTTAAATGTTCCTTTAAACAGATATATGCAGTCTCAATTACCATTCGTATAGTGG TAAGTAATCAATCTTGTATGTATTCTTGAATATCATCAAATAATCTCTTTTTCTATATGATTTCTCACTTTGTGCCTTTTCACAGTTTGGGTTTATGCTCATTGCTCTAATATGGAAGTTCGACTTTTCACCATTCATGGTTTTGATCATTGCTATATTAAACGATGGTG AGTTTTTTTCTTCTCTTTAAAAGCTCTCTCTAAATTTTGGCTCTAATCGACTAACACATCATTAACTTACGCAACAGGAACCATCATGACTATCTCAAAGGACAGAGTCAAGCCTTCTCCAACACCAGATAGCTGGAAACTCAAAGAAATCTTCGCAACCGGCGTTGT TCTTGGAGGCTACATGGCTATAATGACTGTTGTTTTCTTCTGGGCCGCATACAAAACCGATTTCTTCCCGGTATGTAACATATAAACAACCTCTCTTTAGATTCCTTGTCACACAAGCATTAACTTTGTTTGTTTCCTATAGAGAACATTCCACGTGAGAGACTTGAG AGGCAGTGAACATGAGATGATGTCTGCTTTATACTTACAAGTCAGTATTGTGAGCCAAGCTCTTATATTCGTCACTCGATCTAGAAGCTGGTCTTTTACAGAACGACCTGGATATTTCTTGCTAATTGCTTTCTGGGTAGCACAATTGGTAAGCATTGTATCTTCTTG

ATTGATTATAAACTCTCTTGAATGATTGATTCATAAACTTTGACCTTGTAGATTGCAACGGCTATTGCGGTTTACGGTAATTGGGAATTTGCAAGAATCAAAGGAATAGGATGGGGATGGGCTGGAGTAATCTGGCTTTACAGTATTGTCTTCTACTTTCCATTAGA CATAATGAAATTCGCAATCCGTTACATACTAGCCGGAACAGCCTGGAAGAATATCATTGACAACAGGGTACGTTTTGCTTTCTTCTTAGTTCTTCTTCTGAAATGTGATTTTAAGACTTAAACAAAATCTCTCTGTGTCTTTGAAAAAACAGACTGCGTTTACCACTA AGCAAAACTATGGAATAGAGGAGAGGGAAGCACAATGGGCTCATGCACAAAGGACTTTACACGGTCTTCAGAACACTGAAACAGCCAACGTTGTCCCGGAGAGAGGTGGTTACAGAGAACTGTCTGAGATTGCAAATCAAGCCAAGAGACGAGCTGAGATCGCA AGGTAAATGATTTGTAAAAAGTAATTTCGGTTTCTTGTGAGAGAAGTTAACGTTAGGGTTTTTGTTTACAGGCTTAGGGAACTTCATACGCTTAAAGGACATGTAGAGTCAGTGGTGAAGCTAAAGGGACTAGACATTGAGACAGCTGGTCACTACACCGTTTAAT AAAGATTTAACAAGAAGATGATTAAGGAAGAAGAAGATCCTTTTGTTTAAGAGATGATAATGATGATGATTTTATAACAAGAGAATAAGGTTTTTTTTCTGTGTATGTTAAGTTCCTCTAAACTCCTGGGGTTTTTCTTCCTTCCTTATTCATGGTTTTAGACTTTAA TTATAACCATGTGTTTTTGTTTCCCCTCTCTTGAATAAAAAAGAGAAGATACTAATATCATAGGTTTAATACGTTTATGTTTTATAAAAGTTCAATAGATATTGTTTTTGGATATTATGTGAACATAACAATATTTATAAATTCACCTTTCAATTTTCTTATGAGATGA TATCATCTTTACTACTTAAAATATCTTCTAATTAAACCAAAAGCAGATTTAGGTCCGGTTAGATGAATAACCGGTTCGATTAATTTCGTCAGACCGATTTGATCCGTGGATATCATTAATCCGTGGAATACATGTGTGTTCTTGAGTAGGCCACTAGTTATAATCCAC GTGGCAAGCATTTTATCACAAACCCAGAGCTACAAAAACAAAACCAAGAAGACGAGAAGGATCTTTAACAGAGAAAAAAGAGCTTTAGACCAAATCACCAGAAACAAAACAAAAATGTATTTCGCCGCCATAGCTTCTTCACGACAAAGCTTTTTGTCAAACAAT TTCAGTTTCCAACACAGTTTTAAACCCAAATCCAATGTTAACCTCACTCGTCCTAATTCAATCTGTTGTAAATCTTCACACCACGACGACGAAACTGATTCTTCTCGGTAATTTTTATTTACCTTTAGAAAATTTTTTTCCGATTCTAAACTCGGGTTTGGTCTTATTCA ATCTTTTATTTATCTATTGATTAGGAAAAATGAAAATCAGCTGGCGAAGTTGGCAATCGCGACGCTAGCGGTTGGCGTTTTGGCTTATTAAGGAAGAAGAAGATCCTTTTGTTTAAGAGATGATAATGATGATGATTTTATAACAAGAGAATAAGGTTTTTTTTCTG TGTATGTTAAGTTCCTCTAAACTCCTGGGGTTTTTCTTCCTTCCTTATTCATGGTTTTAGACTTTAATTATAACCATGTGTTTTTGTTTCCCCTCTCTTGAATAAAAAAGAGAAGATACTAATATCATAGGTTTAATACGTTTATGTTTTATAAAAGTTCAATAGATATT GTTTTTGGATATTATGTGAACATAACAATATTTATAAATTCACCTTTCAATTTTCTTATGAGATGATATCATCTTTACTACTTAAAATATCTTCTAATTAAACCAAAAGCAGATTTAGGTCCGGTTAGATGAATAACCGGTTCGATTAATTTCGTCAGACCGATTTGA TCCGTGGATATCATTAATCCGTGGAATACATGTGTGTTCTTGAGTAGGCCACTAGTTATAATCCACGTGGCAAGCATTTTATCACAAACCCAGAGCTACAAAAACAAAACCAAGAAGACGAGAAGGATCTTTAACAGAGAAAAAAGAGCTTTAGACCAAATCACC AGAAACAAAACAAAAATGTATTTCGCCGCCATAGCTTCTTCACGACAAAGCTTTTTGTCAAACAATTTCAGTTTCCAACACAGTTTTAAACCCAAATCCAATGTTAACCTCACTCGTCCTAATTCAATCTGTTGTAAATCTTCACACCACGACGACGAAACTGATTCT

TCTCGGTAATTTTTATTTACCTTTAGAAAATTTTTTTCCGATTCTAAACTCGGGTTTGGTCTTATTCAATCTTTTATTTATCTATTGATTAGGAAAAATGAAAATCAGCTGGCGAAGTTGGCAATCGCGACGCTAGCGGTTGGCGTTTTGGCTTTGGGAAGTGTTGGG GATGCGTTTGCGGCCAAAAGCGGTGGAAGAATCGGCGGTCAAGCGTTTCGGTCTTCAGCTCCTCGTCCTCCTCCCAGAATTAACAATCGATCAAGGTAAAATTTTTTACTTGAAGCTCTAATCTCGATTTTAATTATTTAATATGTATATGATTAAAATACTGGCGA AAAAAGTATATATTTAAATTAAGACCTTAATTGAGATTTCTTACAAGAGACTCCATGTATGGGCTTTTAGCAGCCTCATATCCACATTAAAGCCCATTAGTAAACTTTAAGCCTCTTATAATTTTCTATTACACTTTATATTTTGAACCCCATAATTACAATTCGAAT CCAAGATACCCCAACGACCAACACTAATAACTTGATTCAATGCATTAGGCTTTTCTGTTTGCATTATATAATCACGACTTTAGTCTTAGTAGTTAGTACCTTTGCATTCTAAACGCAGCTTTGTTTTCGCAGGACCAACATCTACGTGAATCCTCAGGTTGCACCACC TTTGATCGGTGGCTATGGATATGGTTACGGAGGTTACGGATGGTCACCGTTTTCCTTTTTTGCCCCTGGTCCTGCGGTGGCAGTAGGTGTTGGCGGTGGCTTTGACCTCCTACTTCTCTTCATGTTTTTTGGAGCCGCTTCAGCCGTCGCTAGAAACTTTTTCCGATCA AGAAATGATGAAGATGACGAAGACGACTATTAGAGGAGAAAACGGAGAGAGGCTTATGTAACAATAGTCATACATACGATTTTGTGTAAAAAAATATGATGGAAGAAGACGGATATATGTGGAAATCTTGAAATAAGTAACTAAAGACCCATCTTAAAGTTAAT AGAGGCAATTTGAAAACACCTCCAAATACTAAATTTATATACAAATTTTCTCTGTTTTTCCTTCATTCTTTATATTTTAGGTTCTAGTGTATGACCTCATTGGTCTCCGAAAGCAAGTGAAAATAAATTCTTTAAGCAACCAAATATAAAGAAAACATTGGTATATTT TGTCAATGGTTTATCAGTGTTAACGAAGAAGAATAATTAGACCTAGCTAAAAGTGAAATCAGTAAATCTCGTAAATAATAATAACGATAAATCAGATACAAAAAGAAAATAAAAAAATCAAGAAGAAGACGAAGAAGAAAAAAGAAAGAGTCAGTGAATTAAC AAAAATCAAGAAGAGGTTCGGTTAATACTAAGTCCTTGAAAGAGCCAATGAGGTCTCTTCTTCTCTCGATCCAACGACGTCGTACTTGAGCTGCTCATAGGCGTGTTTGGTCCGCTACTTTCTTGGTTATTATTGCTGTTATTATATAGATTATTATTGCTCTGATTAT TACAATTATCCGATGATGAT... Functional Genomics The analysis of the DNA sequence of genes and genomic regions

reveals evolutionary relationships, and can be used to (amongst a gazillion other things), to... assign function to DNA that codes for peptides, at the physiological level (i.e medical in Humans), at the protein structure level. The Problem(s) Big Problem: Cardiovascular Disease: 40.1% of deaths in 1999 (USA) Genomic Challenges besides being huge recognizing genes in the genome,

Exons/Introns, Alternative Splicing/Termination, Alternate transcription start/stop sites, Tandem Repeats, Psuedogenes, etc.

We dont really understand all there is to know about gene structure, etc. determining the function of the gene, no known homologies,

gene families, etc. Nature: 407, pp. 234 Cardiovascular Disease Lipids major players in heart disease.

Cholesterol, Triglycerides, a steroid alcohol (sterol) used to insulate nerves, produce human sex hormones and as a component in cell membranes, most common fat in the body, energy

storage molecule, produced by the body and supplied by diet. found in fat cells, blood plasma, and cell membranes,

derived from eaten fats or made from other energy sources. Lipoproteins and classes. Apolipoprotein Gene Family A (APOA) Low Density Lipoprotein LDL Associated with HDL, Removes cholesterol from the blood,

Modulates trigyceride levels. Chromosome 11 (H.s.) Several apolipoproteins map to a region of chromosome 11, including two APOA genes, There is a polymorphism that is linked with high serum triglyceride levels that maps to the same region. Hypertriglyceridemia Why bad? high levels have been linked with coronary artery disease,

Normal Borderline High Very High <150 mg/dL 150-199 mg/dL 200-500 mg/dL

>500 mg/dL American Health Association Recommendation Changes in lifestyle habits are the main therapy for hypertriglyceridemia If you're overweight, cut down on calories to reach your ideal body weight. Reduce the saturated fat and cholesterol content of your diet. Reduce your intake of alcohol considerably. Be physically active for at least 30 minutes on most days each week. Substitute monounsaturated and polyunsaturated fats Substitute fish high in omega-3 fatty acids instead of meats that are high in A Solution to finding genes.

Mouse Genome: ~ 2.75 Gb, 19 autosomes + X and Y chromosomes, 99% per cent of the mouse genes have a sequence match in the human genome, 96% lie within 'syntenic' regions of mouse and human chromosomes. Nature 420, 515 - 516 Mus Musculus

Conserved Synteny Description of DNA segments in which gene order is identical between species. The Solution Comparative Genomics % similarity between M.m. and H.s. High homology, no annotation. How did they know the region was expressed?

- not including the Northerns. New Gene Structure? Mouse: 1107 Open Reading Frame (ORF), 368 AA, Human: similar structure, 366 AA, Most similar to each other (71% identity, 78% similarity), Next most similar to APOAIV (27%, 48%) movie The Solution to determining function (I, II).

Mech Dev. 76(1-2) I. Transgenic Mice: - DNA is integrated in a random fashion by injecting it into the pronucleus of a fertilized ovum, wt II. Knock-Out Mice: - DNA is introduced first into embryonic stem (ES) cells. ES cells that have undergone homologous recombination are identified and injected into a 4 day old mouse embryo - a blastocyst.

GFP PNAS 97 Glutamic Acid Decarboxylase 67 Pronucleus: either of the 2 haploid gamete nuclei just prior to their fusion in the fertilized ovum. Transgenic Mice Pronuclear Injection

1, heart; 2, brain; 3, placenta; 4, lung; 5, liver; 6, skeletal muscle; 7, kidney; or 8, pancreas. WT Mouse mRNA hybridized with mouse APOAV cDNA WT Human mRNA hybridized with human APOAV cDNA 1 and 5, transgenic liver; 2 and 6, transgenic intestine;

3 and 7, wild-type liver; and 4 and 8, wild-type intestine. H.s. APOAV probe Fig. 2 APOAV Transgenic Mice overexpressors n=48 (transgenics), n=46 (controls), P < 0.0001 Typical KO vector and homologous recombination.

KO transgenic *tk:thymidine kinase + gancyclovir = lethal KO Mice w/ Embryonic Stem Cells Transformed ES cells are injected into blastocysts Chimeric mouse

Black/White Chimeric Example Cross and look for offspring with germ-line transfection. Ref. 25 Expression of native APOA mRNA. Fig. 2 APOAV KO Mice

underexpressors n=13 (wt), n=22 (hets), n = 10 (homozygous mut.) P < 0.001 Fig. 3 Murine Models are Good but what about us? Identified 4 SNPs in and near the human APOAV locus (each occurs at >8%), Surveyed ~500 Caucasians for numerous lipid parameters before and after high- and low-fat diets, Fig. 1A

1,1 = homozygous for major allele 1,2 = heterozygous for major allele Individuals heterozygous for the minor alleles at SNPs 1-3 had significantly higher triglyceride levels and VLDL mass. SNP4 does not show a significant difference in triglyceride levels or VLDL mass. Linkage disequilibrium: When the observed frequencies of

haplotypes in a population does not agree with haplotype frequencies predicted by multiplying together the frequency of individual genetic markers in each haplotype, English Translation: The co-occurrence of genetic markers more often than would be expected. SNP1, SNP2, & SNP3 have significant disequilibrium with each other while SNP4 is not in linkage disequilibrium with any other SNP, English Translation: this genetic region containing SNP1-3 segregates as a unit. Independent Association Study

Data from an independent set of individuals demonstrating that subjects with minor alleles at SNP3 are significantly more likely to have high triglyceride levels than low. Summary Comparative Genomics uncovered a new gene in the human genome. Mouse transgenic and KO experiments suggest that

the protein contributes to triglyceride and VLDL levels. SNP data shows that APOAV plays a significant role in plasma triglyceride and VLDL homeostasis. Polymorphisms of APOAV could be used as prognostic indicators for hypertriglyceridemia. Modulation of APOAV is a potential strategy for reducing risk of cardiovascular disease. APOAV Update

http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed&cmd=search&term=apoav Weds. ~Genome scale KO experiment.

Recently Viewed Presentations

  • The Business Case for Building the Janssen Brand

    The Business Case for Building the Janssen Brand

    Absence of history of VF on DRV, and if historical genotype available, absence of DRV RAMs† Viral load (VL) <50 c/mL for ≥2 months before screening; one VL≥50 and <200 c/mL within 12 months prior to screening allowed. Creatinine clearance...
  • Coloring the Periodic Table - Families

    Coloring the Periodic Table - Families

    If an element loses 1 electron (1 negative charge) what charge will the resulting ion have? +1. Oxidation numbers. The charge an element would have if it released or obtained electrons to look like a noble gas. ... Coloring the...
  • 1916 Uprising Assessing what the children already know

    1916 Uprising Assessing what the children already know

    The Aud and the Asgard. The Asgard was a relatively small boat (yacht): 900 guns were landed in Howth, Co. Dublin in July 1914 by Erskin Childers and his family. In skirmishes that followed that evening in Dublin, four Irish...
  • SURVEILLANCE ET PRVISION AUTOMATIQUE DES RISQUES SANITAIRES DANS

    SURVEILLANCE ET PRVISION AUTOMATIQUE DES RISQUES SANITAIRES DANS

    la nitrification de l'ammonium, de la dénitrification des nitrates processus, du transfert d'oxygène dissous de l'atmosphère vers la couche de surface du lac, de la dissolution de la silice contenu dans l'opale, de l'adsoption et désorption du phosphore de la...
  • Assessment of the DCLL TBM Failure Modes based

    Assessment of the DCLL TBM Failure Modes based

    SDC-IC Design Rules were reviewed and F82H material properties were collected and extrapolated for SDC-IC (including K IC)Large-scale FEM analysis of the DCLL TBM stress results were broken down into membrane, bending, and total stress along 13 different paths through...
  • Strategy 3: Bedside Shift Report (Tool 3)

    Strategy 3: Bedside Shift Report (Tool 3)

    Strategy 3: Nurse Bedside Shift Report (Tool 3) The ultimate goal of patient and family engagement is to create a set of conditions where patients, family members, clinicians, and hospital staff are all working together - as partners -to improve...
  • Global Positioning System

    Global Positioning System

    Global Positioning System (GPS) Trenton Computer Festival 2004 GPS Haiku In ultimate cold through solar wind you orbit, to warmth you guide me Wife says pull over, no clear view of satellites, ask for directions Batteries are toast, map compass...
  • Capitalization Places and Transportation

    Capitalization Places and Transportation

    "The Dog of Pompeii" Essential Question: How would the story's resolution be different if Bimbo and Tito were different? Plot Structure Exposition Rising Action Climax Falling Action Resolution Theme Characterization "The Dog of Pompeii" Essential Question: How would the story's...